<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Peaksquare1</id>
		<title>HistoryPedia - Внесок користувача [uk]</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Peaksquare1"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=%D0%A1%D0%BF%D0%B5%D1%86%D1%96%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0:%D0%92%D0%BD%D0%B5%D1%81%D0%BE%D0%BA/Peaksquare1"/>
		<updated>2026-04-23T19:43:39Z</updated>
		<subtitle>Внесок користувача</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_every_single_locus_before_the_designing_of_a&amp;diff=305561</id>
		<title>Ent SNPs in every single locus before the designing of a</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_every_single_locus_before_the_designing_of_a&amp;diff=305561"/>
				<updated>2018-03-21T11:02:47Z</updated>
		
		<summary type="html">&lt;p&gt;Peaksquare1: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Primer sequences utilized for in multiplex PCR, SBE and PCR-RFLP.Polimorphic web page Multiplex PCRPCR primer 59-CTGACTGGCATTGTATTAGCA-39 59GTATACGGGTTCTTCGAATG-Position 6960F 7433RSNP analyzedRestriction enzime59-GAGAAGGCTTAGAAGAAAACCCCAC-39 59GTGGGCGATTGATGAAAAGGC-14601F 14950R59-GGCCTATGAGTGAACTACAAAA-39 59TATTCCTAGAAGTGAGATGGT-10364F 10526R59-CCTACCACTCACCCTAGCATTAC-39 59TAGGAATGCGGTAGTAGTTAG-4185F 5120R59-CAACCCCGACATCATTACCGGGT-39 59GGGTTAACGAGGGTGGTAAGG-12106F 12413R59-CCTACCACTCACCCTAGCATTAC-39 59GCGAGCTTAGCGCTGTGATGAG-4185F 4542RSingle Base Extensi on (SBE)59-ACACGACACGTAACTACGTTGTAGC-7004Fm.7028C.T14766 10398 4580 12308 4216 PCRRFLP59cgatcATGAGTGGTTAATTAATTTTATTAGGGTTA-39 59-ataTATGAGTGACTACAAAAAGGATTAGA CTGA-39 59-(at)7TTTTTTACCTGAGTAGGCCTAGAAA TAAACAT-39 59-(tacg)5aCCATTGGTCTTAGGCCCCAA-39 59-cgCCACTCACCCTAGCATTACTTATATG A-39 59-CTTTGGCTTCGAAGCCGCCGCC-39 59TATTCCTAGAAGTGAGATGGT-14798R 10368F 4548F 12288F 4189F 9902F 10526Rm.[http://www.hengzixing.com/comment/html/?901568.html (2008) utilized normative data from many countries to test the concept that] 14766C.T m.10398A.G m.4580G.A m.12308A.G m.4216T.C m.10034T.C (2)AluI59-ATGCCTCAGGATACTCCTCAATAGCCAT C- 39 59CCGTGCGAGAATAATGATGTATGC-14430F 14686Rm.1470T.C(+)AccI59- TAGCCCACTTCTTACCACAAGGC-39 59GTGTGAAAACGTAGGCTTG-8900F 9172Rm.8994G.A(2)HaeIIIR: primer in reverse orientation; F:primer in forward orientation. Samples with all the m.10398G allele had been tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] conducted as outlined by the Spanish Law for Biomedical Analysis (Law 14/2007-3 of July) and complied with the Declaration of Helsinki. The study plus the use of archive samples for this project have been approved by the Research Ethics Committee of Galicia. The National DNA Bank, which offered DNA samples, received the approval from their very own ethical committee. Written informed consent was obtained from all individuals. All of the samples have been collected anonymously.Individuals and ControlsThis case-control followed STREGA recommendations [27]. DNA samples from 781 unrelated Spanish men and women (423 wholesome controls and 358 IC sufferers) had been analysed within this study. The ischemic cardiopathy group included 225 sufferers obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospital Cardiology Unit and 133 offered   by the National DNA Bank (University of Salamanca, Spain). The handle group was an age and sex matched population of donors from A Coruna University Hospital Blood Bank. Individuals in   this group represented both genders and had no history of IC. Ischemic cardiopathy was defined in accordance with the American College of Cardiology and American Heart Association clinical requirements [28]. Details about recognized ischemic cardiopathy risks was collected. Hypercholesterolemia was regarded a threat if total cholesterol levels  220 mg/dl. Hypertension was defined as systolic blood stress  140 mm Hg, diastolic blood pressure  90 mm Hg or by the use of antihypertensive medication. Diabetes mellitus was defined as a self-reported illness, use ofPLOS One particular | www.plosone.orgMt Haplogroups H and J in Ischemic CardiomyopathyTable 1. Primer sequences applied for in multiplex PCR, SBE and PCR-RFLP.Polimorphic website Multiplex PCRPCR primer 59-CTGACTGGCATTGTATTAGCA-39 59GTATACGGGTTCTTCGAATG-Position 6960F 7433RSNP analyzedRestriction enzime59-GAGAAGGCTTAGAAGAAAACCCCAC-39 59GTGGGCGATTGATGAAAAGGC-14601F 14950R59-GGCCTATGAGTGAACTACAAAA-39 59TATTCCTAGAAGTGAGATGGT-10364F 10526R59-CCTACCACTCACCCTAGCATTAC-39 59TAGGAATGCGGTAGTAGTTAG-4185F 5120R59-CAACCCCGACATCATTACCGGGT-39 59GGGTTAACGAGGGTGGTAAGG-12106F 12413R59-CCTACCACTCACCCTAGCATTAC-39 59GCGAGCTTAGCGCTGTGATGAG-4185F 4542RSingle Base Extensi on (SBE)59-ACACGACACGTAACTACGTTGTAGC-7004Fm.7028C.T14766 10398 4580 12308 4216 PCRRFLP59cgatcATGAGTGGTTAATTAATTTTATTAGGGTTA-39 59-ataTATGAGTGACTACAAAAAGGATTAGA CTGA-39 59-(at)7TTTTTTACCTGAGTAGGCCTAGAAA TAAACAT-39 59-(tacg)5aCCATTGGTCTTAGGCCCCAA-39 59-cgCCACTCACCCTAGCATTACTTATATG A-39 59-CTTTGGCTTCGAAGCCGCCGCC-39 59TATTCCTAGAAGTGAGATGGT-14798R 10368F 4548F 12288F 4189F 9902F 10526Rm.14766C.T m.10398A.G m.4580G.A m.12308A.G m.4216T.C m.10034T.C (two)AluI59-ATGCCTCAGGATACTCCTCAATAGCCAT C- 39 59CCGTGCGAGAATAATGATGTATGC-14430F 14686Rm.1470T.C(+)AccI59- TAGCCCACTTCTTACCACAAGGC-39 59GTGTGAAAACGTAGGCTTG-8900F 9172Rm.8994G.A(two)HaeIIIR: primer in reverse orientation; F:primer in forward orientation. *Lower case letters indicate the unspecific nucleotides in 59-end from the SBE primer.&lt;/div&gt;</summary>
		<author><name>Peaksquare1</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=IH-PA_Author_Manuscript_NIH-PA_Author_Manuscript_NIH-PA_Author_ManuscriptDrug_Alcohol_Depend.&amp;diff=305525</id>
		<title>IH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptDrug Alcohol Depend.</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=IH-PA_Author_Manuscript_NIH-PA_Author_Manuscript_NIH-PA_Author_ManuscriptDrug_Alcohol_Depend.&amp;diff=305525"/>
				<updated>2018-03-21T10:05:47Z</updated>
		
		<summary type="html">&lt;p&gt;Peaksquare1: Створена сторінка: Data describing participants' opinions about remnant injection were promising in terms of participant [http://www.medchemexpress.com/Foretinib.html buy GSK13630...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Data describing participants' opinions about remnant injection were promising in terms of participant [http://www.medchemexpress.com/Foretinib.html buy GSK1363089] security. Considerably of the information collected had been self-report information, which leaves open the possibility that when faced with an immediate chance to snort or shoot a tampered solution, a distinctive choice would be produced. Lastly, it really is also achievable that when participants had some time for you to think about the goods immediately after the sessions, they would have come up with new tampering strategies to attempt. To this end, follow-up phone calls the day right after the session may have revealed additional information.IH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptDrug Alcohol Depend. Author manuscript; obtainable in PMC 2013 November 01.Vosburg et al.Pagereassured by the manufacturer that injection was not a problem because the answer contained so small active drug (Carnwath, 1993). Other individuals noted that the issues were because of the active ingredient temazepam and not to the gel formulation per se (Launchbury et al., 1989; Launchbury and Drake, 1992; Russell et al., 1994). Nonetheless, out of general concern for the issue, practitioners from numerous urban regions joined collectively inside a voluntary ban of this formulation (Crompton, 1994; Moley et al., 1994). The DCR oxymorphone formulation isn't a gel capsule, nevertheless it swiftly became a viscous gel following coming into make contact with together with the liquid solvents that had been [https://dx.doi.org/10.1002/wcs.1183 wcs.1183] employed in this study. Although most participants were unwilling to inject options from these formulations, and 60  couldn't produce an extract to inject, there had been still folks who could produce extracts and stated that they would inject them. It really is not identified what will occur when this occurs, nevertheless, it truly is reassuring that there was small intravenous abuse of both oxymorphone quick release and extended release non-crush-resistant formulations reported inside the 2009 Addiction Severity Index-Multimedia Version Connect assessments (Butler et al, 2011). Data describing participants' opinions about remnant injection have been promising in terms of participant security. Namely, 92  wouldn't inject the gelled remnants in the DCR, and 80  wouldn't inject them from OXM. Nonetheless, the extent to which these formulations will be abused intravenously won't be known till they are readily readily available. As has been stated inside the literature, ultimately the capability of any tamper-resistance strategy to deter abuse may have to become gauged by substantial, long-term information collection (Butler et al., 2011; Katz, 2008; Webster et al., 2011; Webster and Fine, 2010). With regard for the present study, the findings should be deemed within the context of the limitations. 4 percent of intranasal customers indicated they wouldn't snort the powder they ready due to the fact they did not recognize the drug. Despite the fact that solely recruiting individuals with practical experience abusing oxymorphone would have avoided this outcome, oxymorphone abuse is hardly ever noticed within this catchment location (Jones et al., 2011). Nonetheless, this information and facts also supports the notion of prescription opioid preferences among these abusers (Budman et al., 2009; Butler [https://dx.doi.org/10.3389/fpsyg.2016.00135 fpsyg.2016.00135] et al., 2006, 2010a, b). Inclusion of a on a regular basis abused prescription opioid, specifically a single with out any abuse-deterrent properties, for instance the previous formulation of OxyContin? would have enabled further comparisons to become produced.&lt;/div&gt;</summary>
		<author><name>Peaksquare1</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_every_locus_before_the_designing_of_a&amp;diff=300407</id>
		<title>Ent SNPs in every locus before the designing of a</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Ent_SNPs_in_every_locus_before_the_designing_of_a&amp;diff=300407"/>
				<updated>2018-03-09T18:11:06Z</updated>
		
		<summary type="html">&lt;p&gt;Peaksquare1: Створена сторінка: The ischemic cardiopathy group integrated 225 individuals obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospi...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The ischemic cardiopathy group integrated 225 individuals obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospital Cardiology Unit and 133 provided   by the National DNA Bank (University of Salamanca, Spain). The handle group was an age and sex matched population of donors from A Coruna University Hospital Blood Bank. Individuals in   this group represented both genders and had no history of IC. Ischemic cardiopathy was defined according to the American College of Cardiology and American Heart Association clinical standards [28]. Information regarding identified ischemic cardiopathy dangers was collected. Hypercholesterolemia was deemed a threat if total cholesterol levels  220 mg/dl. Hypertension was defined as systolic blood stress  140 mm Hg, diastolic blood pressure  90 mm Hg or by the use of antihypertensive medication. Diabetes mellitus was defined as a self-reported disease, use ofPLOS One particular | www.plosone.orgMt Haplogroups H and J in Ischemic CardiomyopathyTable 1. Primer sequences employed for in multiplex PCR, SBE and PCR-RFLP.Polimorphic web-site Multiplex PCRPCR primer 59-CTGACTGGCATTGTATTAGCA-39 59GTATACGGGTTCTTCGAATG-Position 6960F 7433RSNP analyzedRestriction enzime59-GAGAAGGCTTAGAAGAAAACCCCAC-39 59GTGGGCGATTGATGAAAAGGC-14601F 14950R59-GGCCTATGAGTGAACTACAAAA-39 59TATTCCTAGAAGTGAGATGGT-10364F 10526R59-CCTACCACTCACCCTAGCATTAC-39 59TAGGAATGCGGTAGTAGTTAG-4185F 5120R59-CAACCCCGACATCATTACCGGGT-39 59GGGTTAACGAGGGTGGTAAGG-12106F 12413R59-CCTACCACTCACCCTAGCATTAC-39 59GCGAGCTTAGCGCTGTGATGAG-4185F 4542RSingle Base Extensi on (SBE)59-ACACGACACGTAACTACGTTGTAGC-7004Fm.7028C.T14766 10398 4580 12308 4216 PCRRFLP59cgatcATGAGTGGTTAATTAATTTTATTAGGGTTA-39 [http://s154.dzzj001.com/comment/html/?266113.html Cent fMRI research have shown that regions of your rostral anterior] 59-ataTATGAGTGACTACAAAAAGGATTAGA CTGA-39 59-(at)7TTTTTTACCTGAGTAGGCCTAGAAA TAAACAT-39 59-(tacg)5aCCATTGGTCTTAGGCCCCAA-39 59-cgCCACTCACCCTAGCATTACTTATATG A-39 59-CTTTGGCTTCGAAGCCGCCGCC-39 59TATTCCTAGAAGTGAGATGGT-14798R 10368F 4548F 12288F 4189F 9902F 10526Rm.14766C.T m.10398A.G m.4580G.A m.12308A.G m.4216T.C m.10034T.C (two)AluI59-ATGCCTCAGGATACTCCTCAATAGCCAT C- 39 59CCGTGCGAGAATAATGATGTATGC-14430F 14686Rm.1470T.C(+)AccI59- TAGCCCACTTCTTACCACAAGGC-39 59GTGTGAAAACGTAGGCTTG-8900F 9172Rm.8994G.A(2)HaeIIIR: primer in reverse orientation; F:primer in forward orientation. *Lower case letters indicate the unspecific nucleotides in [http://www.dingleonline.cn/comment/html/?245486.html On neuronal integrity and gliosis. On the other hand, the effect of HIV on] 59-end of your SBE primer. PCR products for RFLP analysis have been digested with the corresponding restriction.Ent SNPs in each locus prior to the designing of a reference sequence encompassing all the allelic variants for every single locus. The PCR-RFLP assay was performed on those samples obtaining no haplogroup assigned immediately after the SBE assay. The samples had been amplified with the corresponding primers (Table 1) and digested based on the nucleotide localised at polymorphic site 10398 (m.10398A.G). Samples with the m.10398G allele had been tested forMethods Ethics StatementThe study was [https://dx.doi.org/10.1371/journal.pone.0077579 journal.pone.0077579] conducted based on the Spanish Law for Biomedical Research (Law 14/2007-3 of July) and complied with all the Declaration of Helsinki. The study as well as the use of archive samples for this project have been approved by the Investigation Ethics Committee of Galicia. The National DNA Bank, which offered DNA samples, received the approval from their very own ethical committee. Written informed consent was obtained from all sufferers. All the samples had been collected anonymously.Sufferers and ControlsThis case-control followed STREGA recommendations [27]. DNA samples from 781 unrelated Spanish men and women (423 wholesome controls and 358 IC patients) have been analysed within this study. The ischemic cardiopathy group integrated 225 sufferers obtained from A [https://dx.doi.org/10.3389/fpsyg.2016.01503 fpsyg.2016.01503] Coruna University Hospital Cardiology Unit and 133 offered   by the National DNA Bank (University of Salamanca, Spain). The control group was an age and sex matched population of donors from A Coruna University Hospital Blood Bank.&lt;/div&gt;</summary>
		<author><name>Peaksquare1</name></author>	</entry>

	</feed>