<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Thumbmeat0</id>
		<title>HistoryPedia - Внесок користувача [uk]</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Thumbmeat0"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=%D0%A1%D0%BF%D0%B5%D1%86%D1%96%D0%B0%D0%BB%D1%8C%D0%BD%D0%B0:%D0%92%D0%BD%D0%B5%D1%81%D0%BE%D0%BA/Thumbmeat0"/>
		<updated>2026-08-25T14:34:57Z</updated>
		<subtitle>Внесок користувача</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=IR528_was_drastically_downregulated_by_drought,_plus_the_identical_result_was&amp;diff=278237</id>
		<title>IR528 was drastically downregulated by drought, plus the identical result was</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=IR528_was_drastically_downregulated_by_drought,_plus_the_identical_result_was&amp;diff=278237"/>
				<updated>2018-01-19T09:32:10Z</updated>
		
		<summary type="html">&lt;p&gt;Thumbmeat0: Створена сторінка: (XLS 21 kb) Additional file 7: Differential expression analysis of novel miRNAs under drought stress. (XLS 38 kb) Further file 8: Targets of miRNAs identified b...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;(XLS 21 kb) Additional file 7: Differential expression analysis of novel miRNAs under drought stress. (XLS 38 kb) Further file 8: Targets of miRNAs identified by degradome sequence. (XLS 46 kb) Added file 9: Target plots of identified miRNA targets making use of degradome sequencing. (PDF 762 kb) Extra file 10: Targets of novel miRNAs identified by degradome sequencing. (DOC 57 kb) Further file 11: Targets of known miRNAs predicted by the web tool psRNATarget. (XLS 69 kb) Extra file 12: Targets of novel miRNAs predicted by the internet tool psRNATarget. (XLS 187 kb) Additional file 13: miRNA comparison data amongst unique foxtail millet varieties. (XLSX 17 kb)cotton, Hebei Academy of Agricultural and Forestry Sciences, Shijiazhuang 05003, People's Republic of China. Received: 26 October 2015 Accepted: 1 AprilAbbreviations miRNA: microRNA; sRNA: little RNA; siRNA: modest interfering RNA; ta-siRNAs: trans-acting compact interfering RNA; WUE: water use efficiency; pre-miRNA: precursors of microRNA; LWP: leaf water potential; TPM: Transcript per million; DT: drought-treated group; CL: handle group; MFEs: minimum free energies; DE: differentially expressed.IR528 was significantly downregulated by drought, plus the exact same result was reported in maize. The target gene of miR528 encoded a peroxidase (POD), that is an important element on the antioxidative enzyme program in plants. The downregulation of miR528 may well market the removal of excessive reactive oxygen species (ROS) and help sustain cellar homeostasis in foxtail millet below drought situations. miR395 was enriched in [https://dx.doi.org/10.1037/a0022827 title= a0022827] the drought-treated group, and its putative target was predicted to become a sulfate transporter, SULTR2;1. Regulation of your sulfate assimilation method by means of the miR395 ULTR2;1 interaction had been confirmed in Arabidopsis [89]. Moreover, sulfate transporters play a function in reequilibrating the flux of sulfate involving and inside diverse tissues and improving drought tolerance in plants [66].Conclusions In the present study, we detected 18 miRNA members in 16 families and [https://dx.doi.org/10.1038/srep43317 title= srep43317] predicted 3 novel miRNAs in response to drought in foxtail millet. Moreover, 56 targets for 12 known miRNA households and 26 target genes for 9 novel miRNAs were identified by degradome sequencing in the worldwide level. These benefits offer helpful [http://geo.aster.net/members/goosepillow3/activity/315046/ Raffic occurring among genomics and identity/race: genomics generally requires its] details for the study of drought-responsive miRNAs in foxtail millet. Further research are expected to recognize these miRNAs and their targets employing methods like RLM-RACE. However, it is essential to establish no matter if these genes enhance drought tolerance in transgenic plants. Ethics (and consent to participate) Not applicable. Consent to publish Not applicable.Wang et al. BMC Genetics (2016) 17:Page 14 ofAvailability of data and components Raw data supporting our findings is often located at EMBLEBI European Nucleotide Archive (https://www.ebi.ac.uk/) below accession numbers ERP014347 and ERP014368. More filesAdditional file 1: The survival rate of 10 varieties of foxtail millet under repeated drought treatment options. (TIF 166 kb) Additional file 2: Primers utilized for RT-PCR within this study. (DOC 35 kb) Further file three: Detailed details of identified miRNAs in foxtail millet. (XLS 72 kb) Added file four: Detailed information and facts of novel miRNAs in foxtail millet. (XLS 58 kb) Additional file 5: The secondary structures of novel miRNA precursors (PDF 324 kb) More file six: Differential expression evaluation of known miRNAs under drought pressure.&lt;/div&gt;</summary>
		<author><name>Thumbmeat0</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=278152</id>
		<title>G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=278152"/>
				<updated>2018-01-19T04:39:18Z</updated>
		
		<summary type="html">&lt;p&gt;Thumbmeat0: G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;three Expression levels of recognized miRNA households in CL and DT librariesstress in preceding studies: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified 3 possible novel miRNAs viewed as to become drought-response miRNAs depending on the differential expression amongst the CL and DT libraries. Of these miRNAs, two (sit-novel-miR10, sit-novelmiR56) were upregulated, and 1 (sit-novel-miR18) was downregulated (Additional file 7). To verify the [http://www.medchemexpress.com/MK-571-sodium-salt.html L-660711 sodium salt chemical information] results of miRNA sequencing and bioinformatics evaluation, six identified miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, sit-miR396a, and miR408) and 4 novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) had been selected randomly for validation by qRT-PCR. The results showed that the fold change of expression obtained by qRT-PCR was not absolutely constant with bioinformatics evaluation benefits, however the expression trend was equivalent (Fig. four). The stem-loop secondary structure of 4 novel miRNAs is shown in Fig. 5. These final results suggested that Solexa sequencing was successfully applied to recognize drought-related miRNAs in foxtail millet.Table three Potential novel miRNAs with miRNA* identified in S.G exons, rRNA, tRNA, snoRNA, snRNA, and identified miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs utilizing miRcat software with default plant parameters and psRobot software. A total of 72 novelTo identify drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels had been too low to become analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs among the CL and DT libraries. A total of 18 known miRNAs belonging to 16 families had been significantly expressed with more than 1 log2 fold modify (Additional file 6). Amongst these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) have been upregulated and 4 miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) had been downregulated; a number of these miRNA families have already been related with droughtTable two Statistical analysis of sRNAs for manage (CL) and drought-treatment (DT) librariesCL (control) Type Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA others Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 Percent 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 Percent 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 one hundred.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 % 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 one hundred.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 % 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 100.Wang et al. BMC Genetics (2016) 17:Page six ofTarget prediction of miRNAs and validation by degradome sequencingFig.&lt;/div&gt;</summary>
		<author><name>Thumbmeat0</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Millet,_the_majority_of_miRNA_targets_were_predicted_working_with_bioinformatics,_and&amp;diff=277853</id>
		<title>Millet, the majority of miRNA targets were predicted working with bioinformatics, and</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Millet,_the_majority_of_miRNA_targets_were_predicted_working_with_bioinformatics,_and&amp;diff=277853"/>
				<updated>2018-01-18T08:14:25Z</updated>
		
		<summary type="html">&lt;p&gt;Thumbmeat0: Створена сторінка: Millet, the [http://www.tongji.org/members/fine70priest/activity/626429/ Nce database. The biggest fraction of unannotated sequences could represent novel] majo...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Millet, the [http://www.tongji.org/members/fine70priest/activity/626429/ Nce database. The biggest fraction of unannotated sequences could represent novel] majority of miRNA targets had been predicted employing bioinformatics, and incredibly handful of miRNA targets had been identified experimentally. It has been indicated that conserved miRNAs play a important part in post-transcriptional regulation in plant species [64]. These results [https://dx.doi.org/10.1038/srep43317 title= srep43317] suggest that degradome sequencing is often effectively applied to recognize miRNA targets in foxtail millet with high accuracy and efficiency. Gene function annotation of conserved miRNAs targets showed that the majority of them had been classified into transcription factors. For example, in Arabidopsis and Populus, 95 conserved miRNAs targets have been identified, 68   of these encode transcription factor. In soybean, 82   of miRNA targets had been transcription factors [73]. Very same final results have been also reported in rice [74], maize [75], and grapevine [76]. You can find also some miRNAs target to genes encoding enzymes of fundamental biochemical pathways. As an example, miR397 targets laccase and miR398 targets copper superoxide dismutases. On the other hand, those had been only constitute a minor portion of all identified target genes in plants [64]. Within the present study, 26 targets for 9 novel miRNAs have been identified employing degradome sequencing. Compared with all the targets of recognized miRNAs, the targets of novel miRNA had a wide variety of functions, which includes thoseOur study identified 16 known miRNA families and three novel miRNAs that had been DE in foxtail millet beneath drought situations (Further file six and Additional file 7). Amongst identified miRNAs, 34 special targets of 6 DE miRNA families were validated making use of degradome sequencing (Table four and Fig. 7). As expected, the majority of those DE miRNAs had been connected to drought-stress responses in preceding research [78, 79]. By way of example, our study identified that miR167b-5p was enriched and drastically upregulated in response to drought strain in foxtail millet. Comparable benefits were shown in Arabidopsis [23], rice, and maize [80, 81], which indicates that miR167 can respond to ABA and control stomatal movement. miR390 [https://dx.doi.org/10.1136/bmjopen-2015-010112 title= bmjopen-2015-010112] was reported to be upregulated below drought pressure in Brachypodium distachyon and Vigna unguiculata [69]. In Arabidopsis, miR390 mediated the miR390 asiRNA?ARF regulatory pathway and regulated lateral root development. In foxtail millet, a similar expression pattern and also the identical target gene of miR390 was identified by means of SL-qPCR and degradome sequencing, respectively. These final results suggest that several miRNAs have conserved functions in regulating abiotic stress responses in various plant species. Combined with all the miRNA expression patterns, target prediction, and degradome sequencing final results (Figs. 6 and 7), our study increases our understanding about how foxtail millet An04 responded to water deficiency: i. Growth repression beneath drought situations.Millet, the majority of miRNA targets have been predicted applying bioinformatics, and really handful of miRNA targets had been identified experimentally. Degradome sequencing technologies provides a powerful tool with which to study miRNA arget interactions in the transcriptome level. In this study, we identified 56 targets for 12 identified miRNA households utilizing degradome sequencing. Based on our evaluation, the majority of these targets have a conserved function with miRNA targets in other species. Many of the identified targets from the recognized miRNAs belong to transcription factors, such as miR156 targeting the squamosal promoter-binding household (SPB), miR159 targeting MYB, miR160 targeting many auxin response factors (ARF), and miR164 targeting no apical meristem protein (NAC).&lt;/div&gt;</summary>
		<author><name>Thumbmeat0</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=CGAGCAC_Arm_3p_5p_5p_3p_3p_5p_3p_5p_Length&amp;diff=277470</id>
		<title>CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=CGAGCAC_Arm_3p_5p_5p_3p_3p_5p_3p_5p_Length&amp;diff=277470"/>
				<updated>2018-01-17T11:26:20Z</updated>
		
		<summary type="html">&lt;p&gt;Thumbmeat0: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Immediately after removing adapter sequences and lowquality tags, we obtained a total of 11,762,879 clean reads (three,528,168 special reads) representing the 5' uncapped ends, of which 7,239,426 (two,433,599 exclusive reads) had been completely matched for the S. italica genome. The reads that completely mapped towards the genome were subjected to further [http://femaclaims.org/members/gooseplanet3/activity/1293143/ Ient partnership. The informants assessed that physician-patient relations inside the majority] evaluation applying PAREsnip software [52]. In this study, 56 target genes for 12 known miRNA families [https://dx.doi.org/10.1038/srep43317 title= srep43317] were identified. According to the abundance of degradome tags in the target internet sites, these cleaved targets had been classified into five categories; 42 target genes have been classified into category 0, four target genes into category 1, 6 target genes into category two, 2 target genes into category 3, and 2 target genes into category 4 (Table 4). The detailed data is provided in Additional file 8, as well as the t-plots for targets are illustrated in Extra file 9. The majority of identified miRNAs regulated numerous target genes (ranging from 1 to 11). Amongst them, the sit-miR156 household, with 11 distinctive target genes, had the largest number of target genes; the sit-miR172 and sit-miR393 households had only one particular [https://dx.doi.org/10.1089/jir.2011.0073 title= jir.2011.0073] target gene, plus the other folks had two to eight targets. Functional evaluation of those target genes showed that they had been enriched in transcription variables, such as SBP-box transcription aspect (sit-miR156), MYB (sit-miR159), ARF (sit-miR160), NAC (sit-miR164), HD-zip transcription aspect (sitmiR166), GRAS (sit-miR171), and GRF (sit-miR396). These final results have been constant using a previous study in S. italica as well as other species [8, 35]. Moreover, we identified a total of 26 target genes for 9 novel miRNAs (More file eight, Added file 10).miRNA* sequence ATGGTGTACCGGTTGTTATGC AGGCTAGGCTTGCGACTGGAG CCGTAGCCCCTGCTCCTGATG TGACAACGAGAGAGAGCA CGTGGTGTTGTTTCGGCTCATG TTGAGCCGTGCCAATATCACG TTAGCCAAGAATGACTTGCCTATC GCTCGCTCCTCTTTCTGTCAGCpercursor place scaffold_7:35210708..35210784:scaffold_14:67096..67179:scaffold_5:4967704..4967886:scaffold_8:21627028..21627140:+ scaffold_1:34236041..34236153:+ scaffold_7:30396911..30397013:scaffold_3:6158117..6158229:+ scaffold_4:31435223..31435323:+MFE -30.two -31.four -101.4 -71.two -53.1 -50.three -49.two -66.Wang et al. BMC Genetics (2016) 17:Page 7 ofFig. four Differential expression analysis of conserved and novel drought-responsive miRNAs. a Fold alter (log2) in handle library relative to drought library detected by solexa tiny RNA sequencing. b The relative expression amount of miRNAs measured by RT-qPCR. * implies considerable difference amongst handle and drought pressure at P  0.Unlike the targets of identified miRNAs, most targets of novel miRNAs fell into category 2. Of those 26 target genes, 10 were in category 2, 6 had been in category three, four were in category 4, 3 had been in category 0 and 1. Descriptions from the target gene showed that the target genes of novel miRNAs had much more diverse functions, like hydroxyproline-rich glycoprotein, dirigent-like protein, ubiquitin conjugating enzyme protein, and some unknown genes.CGAGCAC Arm 3p 5p 5p 3p 3p 5p 3p 5p Length (nt) 22 21 21 21 21 21 21In foxtail millet, numerous miRNA targets have been predicted previously [35, 36], but handful of miRNA targets happen to be validated experimentally. To recognize miRNA targets in foxtail millet in the worldwide level, we employed the degradome sequencing strategy to identify target genes for recognized miRNAs and candidate novel miRNAs. Raw sequencing information generated by degradome sequencing are available at EMBL using the accession number ERP014368.&lt;/div&gt;</summary>
		<author><name>Thumbmeat0</name></author>	</entry>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=276999</id>
		<title>G exons, rRNA, tRNA, snoRNA, snRNA, and recognized miRNAs, we pooled</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=G_exons,_rRNA,_tRNA,_snoRNA,_snRNA,_and_recognized_miRNAs,_we_pooled&amp;diff=276999"/>
				<updated>2018-01-16T08:22:41Z</updated>
		
		<summary type="html">&lt;p&gt;Thumbmeat0: Створена сторінка: 3 Expression levels of known miRNA families in CL and DT librariesstress in previous [http://kfyst.com/comment/html/?248545.html Lved in lowering the signals of...&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;3 Expression levels of known miRNA families in CL and DT librariesstress in previous [http://kfyst.com/comment/html/?248545.html Lved in lowering the signals of competing percepts and allowing the] studies: miR156 [31, 61], miR159 [23], miR167 [23, 61], miR395 [62], and miR408 [63]. We also identified 3 potential novel miRNAs deemed to be drought-response miRNAs depending on the differential expression amongst the CL and DT libraries. Of these miRNAs, two (sit-novel-miR10, sit-novelmiR56) had been upregulated, and one particular (sit-novel-miR18) was downregulated (More file 7). To confirm the outcomes of miRNA sequencing and bioinformatics analysis, six recognized miRNAs (sit-miR159b, sit-miR167b, sit-miR390, sit-miR394, sit-miR396a, and miR408) and 4 novel miRNAs (sit-novel-miR15, sitnovel-miR18, sit-novel-miR53, and sit-novel-miR56) have been chosen randomly for validation by qRT-PCR. The results showed that the fold alter of expression obtained by qRT-PCR was not absolutely constant with bioinformatics evaluation benefits, but the expression trend was similar (Fig. four). The stem-loop secondary structure of 4 novel miRNAs is shown in Fig.G exons, rRNA, tRNA, snoRNA, snRNA, and known miRNAs, we pooled the remaining unannotated sRNA sequences of two libraries and predicted novel miRNAs making use of miRcat software program with default plant parameters and psRobot computer software. A total of 72 novelTo determine drought-associated miRNAs of foxtail millet, we removed miRNAs whose expression levels have been too low to be analyzed for differential expression (sequencing frequency [https://dx.doi.org/10.1037/a0022827 title= a0022827] DT libraries) and compared the normalized expression of miRNAs amongst the CL and DT libraries. A total of 18 recognized miRNAs belonging to 16 families have been considerably expressed with a lot more than a single log2 fold adjust (Extra file six). Among these DE miRNAs, 14 miRNAs (sit-miR1432-3p, sit-miR156a-5p, sit-miR156b-5p, sit-miR164a-5p, sit-miR167b-5p, sit-miR 171c-3p, sit-miR2118-3p, sit-miR390-5p, sit-miR394-5p, sit-miR395-3p, sit-miR408-3p, sit-miR529a-3p, sit-miR 529b-3p, and sit-miR827) were upregulated and four miRNAs (sit-miR159b-3p, sit-miR319c-5p, sit-miR528-5p and sit-miR535-5p) have been downregulated; a number of these miRNA households have already been connected with droughtTable two Statistical analysis of sRNAs for handle (CL) and drought-treatment (DT) librariesCL (control) Sort Exon antisense Exon sense Intron antisense Intron sense miRNA rRNA repeat tRNA other people Total Uniq sRNAs 137 394 34 225 8698 98782 10278 7782 1361528 1487858 % 0.01 0.03 0.00 0.02 0.58 6.64 0.69 0.52 91.51 one hundred.00 Total sRNA 141 491 35 252 117589 2310754 184428 217892 11292502 14124084 % 0.00 0.00 0.00 0.00 0.83 16.36 [https://dx.doi.org/10.1038/srep18714 title= srep18714] 1.31 1.54 79.95 one hundred.00 DT (drought-treatment) Uniq sRNAs 94 180 29 91 7814 118155 10425 9434 1433632 1579854 % 0.01 0.01 0.00 0.01 0.49 7.48 0.66 0.60 90.74 one hundred.00 Total sRNA 95 191 29 93 104080 2026243 197797 152753 7893561 10374842 Percent 0.00 0.00 0.00 0.00 1.00 19.53 1.91 1.47 76.08 100.Wang et al. BMC Genetics (2016) 17:Web page six ofTarget prediction of miRNAs and validation by degradome sequencingFig.&lt;/div&gt;</summary>
		<author><name>Thumbmeat0</name></author>	</entry>

	</feed>