<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="uk">
		<id>http://istoriya.soippo.edu.ua/index.php?action=history&amp;feed=atom&amp;title=Secret_Techniques_To_Verteporfin</id>
		<title>Secret Techniques To Verteporfin - Історія редагувань</title>
		<link rel="self" type="application/atom+xml" href="http://istoriya.soippo.edu.ua/index.php?action=history&amp;feed=atom&amp;title=Secret_Techniques_To_Verteporfin"/>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Secret_Techniques_To_Verteporfin&amp;action=history"/>
		<updated>2026-07-09T12:48:04Z</updated>
		<subtitle>Історія редагувань цієї сторінки в вікі</subtitle>
		<generator>MediaWiki 1.24.1</generator>

	<entry>
		<id>http://istoriya.soippo.edu.ua/index.php?title=Secret_Techniques_To_Verteporfin&amp;diff=183357&amp;oldid=prev</id>
		<title>Bronzeedge83: Створена сторінка: The oligonucleotide sequences used for the cDNA amplification were: 5�� TACCATGGCATTTGTTTCAGACCAAGT 3�� and 5�� TAAAGCTTCTAGTCCCTTACTATTCCAG 3��...</title>
		<link rel="alternate" type="text/html" href="http://istoriya.soippo.edu.ua/index.php?title=Secret_Techniques_To_Verteporfin&amp;diff=183357&amp;oldid=prev"/>
				<updated>2017-06-01T06:19:46Z</updated>
		
		<summary type="html">&lt;p&gt;Створена сторінка: The oligonucleotide sequences used for the cDNA amplification were: 5�� TACCATGGCATTTGTTTCAGACCAAGT 3�� and 5�� TAAAGCTTCTAGTCCCTTACTATTCCAG 3��...&lt;/p&gt;
&lt;p&gt;&lt;b&gt;Нова сторінка&lt;/b&gt;&lt;/p&gt;&lt;div&gt;The oligonucleotide sequences used for the cDNA amplification were: 5�� TACCATGGCATTTGTTTCAGACCAAGT 3�� and 5�� TAAAGCTTCTAGTCCCTTACTATTCCAG 3��. After confirmation of the sequences, these plasmids were electroporated into the SL1344 ST strain. Bacteria grown in liquid culture were tested for OVA and flagellin expression. [http://en.wikipedia.org/wiki/Tubulin Tubulin] Spleens were obtained from C57BL/6J mice infected with 107 bacteria after 1?day of infection. Cytosolic and noncytosolic proteins were isolated following cell lysing in isotonic buffer and differential centrifugation (R��ssmann et?al., 2001; Timmons et?al., 2011). Samples were normalized for cell number and were loaded on SDS-10% polyacrylamide gels and OVA and actin expression measured by enhanced chemiluminescence. Aliquots of spleen cells (5?�� 106) were incubated in 80?��l PBS plus 1% BSA (PBS-BSA) with anti-CD16/32 at 4��C. After 10?min, cells were stained with H-2KbOVA257�C264 tetramer-PE (Beckman Coulter) and various antibodies (anti-CD8 PercP-Cy5, anti-CD62L APC-Cy7, anti-CD127 PE-Cy7, and anti-CD45.1 APC) for [http://www.selleckchem.com/products/nlg919.html see more] 30?min. Cells were washed with PBS, fixed with 1% formaldehyde, and acquired on BD Biosciences Flow Cytometer. All antibodies were obtained from BD Biosciences. T-regs were enumerated using Mouse T-regulatory T?cell Staining kit (e-Bioscience Cat#88-8115). Intracellular staining was done according to the manufacturer��s protocol. Antigen presentation was done as described previously (van Faassen et?al., 2004; Albaghdadi et?al., 2009). For in?vitro antigen presentation, IC-21 macrophages (H-2b) were pulsed with the bacteria, followed by removal of extracellular bacteria with gentamicin and incubation with CFSE-labeled OT-1 cells for 3?days. For in?vivo antigen presentation, mice were infected with bacteria, followed by adoptive transfer of CFSE-labeled OT-1 cells at various time intervals. Four days after the OT-1 transfer, spleens were removed from recipient mice and the reduction in CFSE expression on donor OT-1 cells was evaluated. Enumeration of IFN-��-secreting cells was done by ELISPOT assay as previously described (Dudani et?al., 2002). In?vivo cytolytic activity of antigen-specific CD8+ T?cells was enumerated as previously described (Tzelepis et?al., 2008). Serum was collected for proteomic analysis using the Mouse Proteome Array kit (R&amp;amp;D Systems). Expression of cytokines/chemokines was quantitated by chemiluminescence [http://www.selleckchem.com/products/Verteporfin(Visudyne).html Verteporfin] detected using a Fluorochem 8900 imager (Alpha Innotech). Densitometric expression values were enumerated using AlphaEase software and were corrected to the internal positive controls and expressed as mean fold change over uninfected samples. The values of samples were compared by one-way ANOVA followed by Tukey HSD tests available at the site http://faculty.vassar.edu/lowry/VassarStats.html. The differences were considered significant when the p value was&lt;/div&gt;</summary>
		<author><name>Bronzeedge83</name></author>	</entry>

	</feed>